Archives

  • 2022-07
  • 2022-05
  • 2022-04
  • 2021-03
  • 2020-08
  • 2020-07
  • 2020-03
  • 2019-11
  • 2019-10
  • 2019-09
  • 2019-08
  • 2019-07
  • br Among NPs fabricated from different polymers human

    2022-05-23


    Among NPs fabricated from different polymers, human serum albu-min NPs have been considered because of some advantages such as high stability during storage and in vivo, excellent biocompatibility, biode-gradability, being non-toxic and non-antigenic [18]. Albumin has been known as a potent drug carrier in the history of pharmacology. In this context, low-molecular weight drugs could be coupled to endogenous albumin, conjugated with exogenous albumin or encapsulated into al-bumin nanoparticles [19]. Among these approaches, albumin nanopar-ticles have attracted more attention in the clinical setting due to high drug loading capacity [20]. Moreover, there are many amine and car-boxyl functional groups in the albumins' surface which can be used for surface modification results in targeting ability and unique responsibil-ity [21]. Indeed, surface modification of NPs with targeting molecules is essential for anticancer drugs which can enhance drug concentration in the targeted organs or tissues leads to decreasing the drug dosage and toxic side effects.
    In this study, to address the aforementioned issues, curcumin as a hydrophobic drug was encapsulated in human serum albumin nanopar-ticles via desolvation method. Furthermore, for targeted drug delivery to HER2 positive breast cancer cells, a HER2-bonding aptamer (HB5) was conjugated to the surface of albumin nanoparticles through EDC/ NHS reagents. The cellular uptake of targeted NPs by HER2 positive breast cancer Adrucil has been compared to the HER2 negative cells. The obtained aptamer-functionalized NPs show tumor cell-targeting ability for HER2 positive breast cancer cells (SK-BR3) attributed to the surface aptamer modification.
    2. Materials and methods
    N-hydroxysulfosuccinimide (NHS), 1-ethyl3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), 3-(4, 5-dimethythiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT), and Human Serum Albumin (HSA) were purchased from Sigma-Aldrich (USA). Curcumin (CB0346) was purchased from Bio Basic Inc. The cell culture medium (DMEM) and antibiotics (penicillin, streptomycin) were obtained from GibcoBRL (Life Technologies, Paisley, Scotland), fetal bovine serum (FBS) was obtained from Biosera (England). Other salts and solvents were purchased from Merck (Germany). All materials were used without any further purification.
    MCF-7 and SK-BR3 cells were a kind gift from Department of Immu-nology, School of Public Health, Tehran University of Medical Sciences.
    An ssDNA-aptamer for HER-2 antigen reported previously [10] was employed as the targeting ligand. The 3′-NH2 and 5′-Cy5 modified HB5 DNA aptamer (HB5 sequence: 5′AACCGCCCAAATCCCTAAGAGTCT GCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTA CACACGCACA-3′, 86 bp) was synthesized by Calgary University (Canada). 
    2.2. Preparation of HSA nanoparticles
    Curcumin-loaded HSA nanoparticles were prepared by a desolvation method, as described previously with minor modifications [22]. In Adrucil es-sence, 100 mg of HSA was dissolved in 1.0 mL of Milli-Q water. Under constant stirring at 550 rpm at room temperature, CCM solution (4 mg in 1.0 mL ethanol) was added with the rate of 1.0 mL/min until turbidity was appeared in the solution. Then, 20 μL of 25% glutaralde-hyde solution was added to induce particle crosslinking under stirring of the suspension over a time period of 12 h. For purification of HSA NPs, the coarse particles were removed by centrifugation at 5000 ×g for 3 min at 4 °C. The supernatant were purified by three cycles of cen-trifugation (28,000 ×g, 20 min at 4 °C) in water at pH 7.4, the pellet of which was redispersed using an ultrasonication bath (Wised WUC-D10H) for 5 min. In order to prepare blank HSA NPs, 1.0 mL ethanol without CCM was added to HSA solution and experiments performed as mentioned above.
    2.3. Determination of particle size and size distribution