Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • In another tail intravenous injection mouse model

    2019-10-15

    In another tail intravenous injection mouse model, animals injected with sh-HDLBP cells exhibited a reduced tumor burden in lung, i.e. reduced lung metastases detected by HE staining (http://www. sciencedirect.com/science/article/pii/S0304383517300691 Fig. 6E,F). These findings suggested HDLBP can promote the tumor formation and metastasis of SCLC cells in vivo, and HDLBP inhibition could reverse the malignant phenotype of SCLC cells, representing a promising therapy target in SCLC.
    W. Zhou, et al. Experimental Cell Research xxx (xxxx) xxx–xxx
    Fig. 5. HDLBP affects Paclitaxel (Taxol) G1/S transition. (A,B) Representative cell cycle distribution plots of H446 cells transfected with control siRNA or HDLBP specific siRNA (A). The percentages of cells in G0/G1 phase, S phase and G2/M phase were quantified by ModFit LT software, n=3 in each group (B). (C) Immunoblotting of indicated proteins in H446 cells transfected with control siRNA or HDLBP siRNA. Differences in measured variables between groups were assessed using the Student’s t-test, *P < 0.05.
    3. Discussion and conclusion
    In this work, we first identified a new potential SCLC biomarker HDLBP using SCLC specific aptamers. Then we validated the clinical value of HDLBP with clinical samples. Lastly, we unveiled the mole-cular functions of HDLBP in cell proliferation, metastasis in vitro and tumorigenesis in vivo for SCLC.
    SCLC is currently characterized as a recalcitrant cancer, and our knowledge about SCLC is limited. Here, we reported, for the first time, HDLBP is a tumor marker of SCLC. According to previous studies, HDLBP was found to be overexpressed in liver cancer tissues and a few human cancer cell lines such as ovarian cancer and gastric cancer, suggesting HDLBP may act as an oncogene. However, in breast cancer, HDLBP acts as a tumor suppress gene by inhibiting the expression of proto-oncogene c-fms. In this work, we not only confirmed HDLBP is overexpressed in SCLC, but also uncovered the new function of HDLBP, which promotes the cell cycle G1/S transition for tumor progression in SCLC. Our results provide valuable information for a better under-standing of the molecular mechanism of SCLC as well as the functions of HDLBP in cancer progression. Of course, more researches are needed in future to explore the detailed mechanism of HDLBP and relationship between cholesterol metabolism and cancer.
    Worthy of noting is that HDLBP is also a promising therapeutic target in SCLC. A natural product, Aralin, has shown encouraging anti-cancer effect in vitro and in vivo (with a cervical cancer mice model). The latest mechanism research proved the cell membrane-located HDLBP is the primary target of Aralin in tumor inhibition. Although the preparation of the polypeptide Aralin from the plant is currently not an easy approach (Aralia contains two polypeptide chains, Aralin A chain with 25 amino acids and Aralin B chain with 26 amino acids, highly glycosylated and currently could only be purified from plant Aralia elata), the potential of developing HDLBP based SCLC target therapy can be expected by using Aralin or other selected HDLBP inhibitors. 
    4. Materials and methods
    Aptamer synthesis and target purification: All the oligonucleo-tides ( RTT:aattttttaattatttatatta, C1: ctggatcttaaagattgcatgcgctcac tatggga; C3:tccgtgccactggcccccggtgccccggtccccgg, C7:gccgatgtcaactttttc taactcactggttttgc, C12: gtggattgttgtgttctgttggtttttgtgttgtc and AS1411: ggtggtggtggttgtggtggtggtgg ) were synthesized by Invitrogen (Shanghai, China). For targets purification, cell lysates were prepared using MgCl2 containing lysate buffer (PBS containing 1% Triton X-100, a protease inhibitor cocktail (1:50, PPLYGEN, Beijing, China, P1265), phosphatase inhibitors (1:100, PPLYGEN, Beijing, China, P1260), and 5 mM MgCl2). The cell lysates were collected and 1mg proteins were incubated with biotin-labeled aptamers at 4 °C for 30 min. The protein-aptamer com-plexes were collected by streptavidin-coated sepharose beads. The collected beads were rinsed three times with wash buffer (1 × PBS containing 4.5 g/L glucose, 5 mM MgCl2 and 0.1% NP-40). The proteins were eluted and analyzed by 10% SDS-PAGE and stained with Coomassie brilliant Blue R250. The aptamer pull-down protein bands were excised, digested and analyzed by LC-MS at Capital Bio Beijing (Beijing, China).