Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Western blot analysis br Equal quantities of extract

    2020-08-30


    2.11. Western blot analysis
    Equal quantities of extract (25 μg of total protein) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the proteins were transferred to polyvinylidene fluoride (PVDF) membranes. After blocking, the membranes were sequentially incubated with primary and secondary 474-25-9 diluted in 5% bovine serum albumin. Horseradish peroxidase (HRP)-labeled immunoglobulin (IgG) was used as the secondary antibodies for detection. Antibodies were obtained from Cell Signaling Technology (Beverly, MA, USA). The expression of the proteins was studied using AlphaImager 2200 (Bio-Techne, Minneapolis, MN, USA).
    Table 1 List of gene specific primers for PCR.
    Nanog AAGGCCTCAGCACCTACCTA TGCACCAGGTCTGAGTGTTC Klf4 ATGCTCACCCCACCTTCTTC TTCTCACCTGTGTGGGTTCG Oct-4 GGTGGAGGAAGCTGACAACA ATCTGCTGCAGTGTGGGTTT CD24 AACAGCCAGTCTCTTCGTGG AGACGCCATTTGGATTGGGT CD44 CCCATTCGACAACAGGGACA TGGGGTGTGAGATTGGGTTG Caspase-3 CCTGGTTCATCCAGTCGCTT TCTGTTGCCACCTTTCGGTT Caspase-8 CAGAGCCTGAGAGAGCGATG AGGCTGAGGCATCTGTTTCC Caspase-9 CAAGAGTGGCTCCTGGTACG CGAAACAGCATTAGCGACCC Bax ACTGAAGCGACTGATGTCCC CAAAGATGGTCACGGTCTGC Bcl-2 GAACTGGGGGAGGATTGTGG GCCGGTTCAGGTACTCAGTC CDK2 GGCACGTACGGAGTTGTGTA ACCCTCAGTCTCAGTGTCCA CDK4 CAGATGGCACTTACACCCGT CAACTGGTCGGCTTCAGAGT Cyclin D1 CAGATCATCCGCAAACACGC AAGTTGTTGGGGCTCCTCAG Pin1 AGCTCAGGCCGAGTGTACTA CTCCTTGGTCCGGGTGATC Akt GGACAAGGACGGGCACATTA CGACCGCACATCATCTCGTA P65 CCTATAGAAGAGCAGCGTGGG AGATCTTGAGCTCGGCAGTG STAT3 AGCAGCACCTTCAGGATGTC GCATCTTCTGCCTGGTCACT P38 GTGGCCACTAGGTGGTACAG CTCGGCCATTATGCATCCCA JNK TAAAGCCAGTCAGGCAAGGG TGGTGGAGCTTCTGCTTCAG Actin GGTCACCAGGGCTGCTTTTA GGATCTCGCTCCTGGAAGATG
    Cytokines in culture medium were detected using a BD Cytometric Bead Array (CBA) Human Th1/Th2/Th17 Cytokine Kit (BD Bioscience, San Jose, CA, USA). The kit simultaneously measures Interleukin-2 (IL-2), Interleukin-4 (IL-4), Interleukin-6 (IL-6), Interleukin-10 (IL-10), Tumor Necrosis Factor (TNF), Interferon-γ (IFN-γ), and Interleukin-17A (IL-17A) protein levels in a single sample. The operations were per-formed according to the manufacturer's instructions. Samples were measured on Flow Cytometer (BD FACSCanto, San Jose, CA, USA).
    2.13. Statistical analysis
    All data were expressed as the mean ± S.D. and analyzed using SPSS 17.0 software. All experiments were repeated at least three times. Statistically significant differences between groups were determined using Student's t-tests. P values < 0.05 were regarded as statistically significant.
    3. Results
    3.1. Celastrol inhibits the proliferation and induces G2/M cell cycle arrest in ovarian cancer cells
    The MTT assay showed that the proliferation of A2780, OVCAR3,
    and SKOV3 was suppressed by celastrol in a dose-dependent and time-
    dependent manner. The suppression of SKOV3 cell proliferation was a
    higher than that of the other two cell types (Fig. 1A). Cell cycle analysis
    showed that compared with the untreated group, celastrol treatment significantly increased the G2/M phase from 9.44 ± 1.77% to
    30.47 ± 4.99%, and 31.97 ± 5.51% in SKOV3 cells at doses of 0.25, 0.5 and 1 μM, respectively (Fig. 1B and C). Celastrol reduced the po-pulation in S Phase, but had no significant influence on the G0/G1 phase. The results revealed that celastrol caused G2/M phase arrest in a dose-dependent manner in A2780, OVCAR3 and SKOV3 cells. To some extent, SKOV3 cells were much more sensitive to celastrol than A2780 and OVCAR3. To further illuminate the mechanism of cell cycle arrest induced by celastrol, the SKOV3 cells treated with celastrol for 24 h showed that the expression of CDK2, CDK4 and Cyclin D1 was down-regulated greatly using RT-qPCR (Fig. 1D) and by western blot (Fig. 1E).
    3.2. Celastrol induces apoptosis in ovarian cancer cells
    To study whether celastrol was able to induce apoptosis in A2780, OVCAR3 and SKOV3 cells, the apoptosis assay was performed. As the concentration of celastrol increased, both early and late numbers of apoptotic cells increased. The greatest effect was registered in SKOV3 cells with an increase from 4.2% to 10.0% in early apoptotic cells and 3–27.4% in late apoptotic cells (Fig. 2A and B). These results confirmed that the anti-cancer activity of celastrol in ovarian cancer cells is related to the induction of apoptosis. To further illuminate the mechanism of apoptosis induced by celastrol, the SKOV3 cell was treated with celas-trol for 24 h and the RT-qPCR (Fig. 2C) and western blot (Fig. 2D) re-sults showed that the levels of Caspase-3, Caspase-8, and Bax were significantly increased and the expression of Bcl-2 was downregulated greatly by treatment with celastrol.